Review



egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3  (Genechem)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Genechem egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3
    Egfr Knockdown Lentiviral Vectors Shctrl, Shegfr 1, Shegfr 2, Shegfr 3, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/egfr+knockdown+lentiviral+vectors+shctrl++shegfr+1++shegfr+2++shegfr+3/pmc09132982-279-8-26
    Average 90 stars, based on 1 article reviews
    egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Importance of PNO1 for growth and survival of urinary bladder carcinoma: Role in core‐regulatory circuitry
    Article Snippet: Lentivirus carrying the PNO1 gene interfering shRNA sequence (shPNO1, target sequence 5′‐TGAACAATTTCAGTCATTT‐3′) or non‐silencing control (shCtrl, target sequence 5′‐TTCTCCGAACGTGTCACGT‐3′) was constructed by GeneChem, Shanghai, China.

    Transduction:

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression.
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’- T T G A A T A A G C C T G A A G T G A A T-3’; GeneChem), Non-targeting shCtrl (5’- T T C T C C G A A C G T G T C A C G T-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’-TTGAATAAGCCTGAAGTGAAT-3’; GeneChem), Non-targeting shCtrl (5’-TTCTCCGAACGTGTCACGT-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Sequencing:

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression.
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’- T T G A A T A A G C C T G A A G T G A A T-3’; GeneChem), Non-targeting shCtrl (5’- T T C T C C G A A C G T G T C A C G T-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’-TTGAATAAGCCTGAAGTGAAT-3’; GeneChem), Non-targeting shCtrl (5’-TTCTCCGAACGTGTCACGT-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Article Title: RAD52 motif‑containing protein 1 promotes non‑small cell lung cancer cell proliferation and survival via cell cycle regulation.
    Article Snippet: .. The target sequence for RDM1-specific shRNA (shRDM1: 5'-GGC CCA TCC TGG TTT CTA T-3') and the negative control shRNA (shCtrl: 5'-TTC TCC GAA CGT GTC ACG T-3') were obtained from GeneChem Biotech (Shanghai, China). .. The NCI-H1299 cell line was transfected with shRDM1 or shCtrl using transfection reagents (c1507; Applygen Technologies, Inc., Beijing, China) according to the manufacturer's instructions.

    Mutagenesis:

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression.
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’- T T G A A T A A G C C T G A A G T G A A T-3’; GeneChem), Non-targeting shCtrl (5’- T T C T C C G A A C G T G T C A C G T-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’-TTGAATAAGCCTGAAGTGAAT-3’; GeneChem), Non-targeting shCtrl (5’-TTCTCCGAACGTGTCACGT-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Construct:

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression.
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’- T T G A A T A A G C C T G A A G T G A A T-3’; GeneChem), Non-targeting shCtrl (5’- T T C T C C G A A C G T G T C A C G T-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    Article Title: KIF11 variants in familial exudative vitreoretinopathy leading to mTORC1 overactivation and impaired cell cycle progression
    Article Snippet: HEK293T and HRECs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. HRECs were plated in 6-cm dishes at 20% confluency and transduced with lentiviral particles carrying either shKIF11 (target sequence: 5’-TTGAATAAGCCTGAAGTGAAT-3’; GeneChem), Non-targeting shCtrl (5’-TTCTCCGAACGTGTCACGT-3’), WT KIF11-overexpressing, or mutant KIF11-overexpressing constructs. .. 72 h post-transduction, cells were collected and lysed using ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100) supplemented with protease inhibitors (MCE).

    shRNA:

    Article Title: RAD52 motif‑containing protein 1 promotes non‑small cell lung cancer cell proliferation and survival via cell cycle regulation.
    Article Snippet: .. The target sequence for RDM1-specific shRNA (shRDM1: 5'-GGC CCA TCC TGG TTT CTA T-3') and the negative control shRNA (shCtrl: 5'-TTC TCC GAA CGT GTC ACG T-3') were obtained from GeneChem Biotech (Shanghai, China). .. The NCI-H1299 cell line was transfected with shRDM1 or shCtrl using transfection reagents (c1507; Applygen Technologies, Inc., Beijing, China) according to the manufacturer's instructions.

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1.
    Article Snippet: .. To generate the cellular knock‐ down model, CCT3 shor t hairpin RNA (shRNA; 5'‐GCTGTGAAGCTGCAGACTT‐3') and shRNA negative control (shCtrl; 5'‐TTCTCCGAACGTGTCACGT‐3') were designed by Shanghai GeneChem Co., Ltd. A lentivirus expres‐ sion cassette expressing CCT3 shRNA was cloned as described in a previous study (16). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6‐MCS‐CBh‐GFP‐IRES‐puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1
    Article Snippet: All cells were cultured in RPMI-1640 medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37°C (5% CO 2 ). .. To generate the cellular knockdown model, CCT3 short hairpin RNA (shRNA; 5′-GCTGTGAAGCTGCAGACTT-3′) and shRNA negative control (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were designed by Shanghai GeneChem Co., Ltd. A lentivirus expression cassette expressing CCT3 shRNA was cloned as described in a previous study ( ). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6-MCS-CBh-GFP-IRES-puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: DNAJC12 promotes lung cancer growth by regulating the activation of β-catenin
    Article Snippet: .. Short hairpin RNA (shRNA/sh) targeting DNAJC12 (shDNAJC12; 5′-GGATGTGATGAACTATCTT-3′) and control shRNA (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were cloned into GV115 plasmids (Shanghai GeneChem Co., Ltd.). .. For overexpression, the coding sequences of CTNNB1 (NM_001904.4), p65 (NM_021975.4), VIM (NM_003380.5) were cloned into GV610 vectors (Shanghai GeneChem Co., Ltd.).

    Negative Control:

    Article Title: RAD52 motif‑containing protein 1 promotes non‑small cell lung cancer cell proliferation and survival via cell cycle regulation.
    Article Snippet: .. The target sequence for RDM1-specific shRNA (shRDM1: 5'-GGC CCA TCC TGG TTT CTA T-3') and the negative control shRNA (shCtrl: 5'-TTC TCC GAA CGT GTC ACG T-3') were obtained from GeneChem Biotech (Shanghai, China). .. The NCI-H1299 cell line was transfected with shRDM1 or shCtrl using transfection reagents (c1507; Applygen Technologies, Inc., Beijing, China) according to the manufacturer's instructions.

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1.
    Article Snippet: .. To generate the cellular knock‐ down model, CCT3 shor t hairpin RNA (shRNA; 5'‐GCTGTGAAGCTGCAGACTT‐3') and shRNA negative control (shCtrl; 5'‐TTCTCCGAACGTGTCACGT‐3') were designed by Shanghai GeneChem Co., Ltd. A lentivirus expres‐ sion cassette expressing CCT3 shRNA was cloned as described in a previous study (16). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6‐MCS‐CBh‐GFP‐IRES‐puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1
    Article Snippet: All cells were cultured in RPMI-1640 medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37°C (5% CO 2 ). .. To generate the cellular knockdown model, CCT3 short hairpin RNA (shRNA; 5′-GCTGTGAAGCTGCAGACTT-3′) and shRNA negative control (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were designed by Shanghai GeneChem Co., Ltd. A lentivirus expression cassette expressing CCT3 shRNA was cloned as described in a previous study ( ). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6-MCS-CBh-GFP-IRES-puromycin; Shanghai GeneChem Co., Ltd.).

    Knockdown:

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1.
    Article Snippet: .. To generate the cellular knock‐ down model, CCT3 shor t hairpin RNA (shRNA; 5'‐GCTGTGAAGCTGCAGACTT‐3') and shRNA negative control (shCtrl; 5'‐TTCTCCGAACGTGTCACGT‐3') were designed by Shanghai GeneChem Co., Ltd. A lentivirus expres‐ sion cassette expressing CCT3 shRNA was cloned as described in a previous study (16). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6‐MCS‐CBh‐GFP‐IRES‐puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1
    Article Snippet: All cells were cultured in RPMI-1640 medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37°C (5% CO 2 ). .. To generate the cellular knockdown model, CCT3 short hairpin RNA (shRNA; 5′-GCTGTGAAGCTGCAGACTT-3′) and shRNA negative control (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were designed by Shanghai GeneChem Co., Ltd. A lentivirus expression cassette expressing CCT3 shRNA was cloned as described in a previous study ( ). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6-MCS-CBh-GFP-IRES-puromycin; Shanghai GeneChem Co., Ltd.).

    Expressing:

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1.
    Article Snippet: .. To generate the cellular knock‐ down model, CCT3 shor t hairpin RNA (shRNA; 5'‐GCTGTGAAGCTGCAGACTT‐3') and shRNA negative control (shCtrl; 5'‐TTCTCCGAACGTGTCACGT‐3') were designed by Shanghai GeneChem Co., Ltd. A lentivirus expres‐ sion cassette expressing CCT3 shRNA was cloned as described in a previous study (16). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6‐MCS‐CBh‐GFP‐IRES‐puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1
    Article Snippet: All cells were cultured in RPMI-1640 medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37°C (5% CO 2 ). .. To generate the cellular knockdown model, CCT3 short hairpin RNA (shRNA; 5′-GCTGTGAAGCTGCAGACTT-3′) and shRNA negative control (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were designed by Shanghai GeneChem Co., Ltd. A lentivirus expression cassette expressing CCT3 shRNA was cloned as described in a previous study ( ). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6-MCS-CBh-GFP-IRES-puromycin; Shanghai GeneChem Co., Ltd.).

    Clone Assay:

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1.
    Article Snippet: .. To generate the cellular knock‐ down model, CCT3 shor t hairpin RNA (shRNA; 5'‐GCTGTGAAGCTGCAGACTT‐3') and shRNA negative control (shCtrl; 5'‐TTCTCCGAACGTGTCACGT‐3') were designed by Shanghai GeneChem Co., Ltd. A lentivirus expres‐ sion cassette expressing CCT3 shRNA was cloned as described in a previous study (16). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6‐MCS‐CBh‐GFP‐IRES‐puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: Upregulation of CCT3 promotes cervical cancer progression through FN1
    Article Snippet: All cells were cultured in RPMI-1640 medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37°C (5% CO 2 ). .. To generate the cellular knockdown model, CCT3 short hairpin RNA (shRNA; 5′-GCTGTGAAGCTGCAGACTT-3′) and shRNA negative control (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were designed by Shanghai GeneChem Co., Ltd. A lentivirus expression cassette expressing CCT3 shRNA was cloned as described in a previous study ( ). .. Briefly, after annealing, shRNA fragments were integrated into a lentiviral GV493 vector (hU6-MCS-CBh-GFP-IRES-puromycin; Shanghai GeneChem Co., Ltd.).

    Article Title: DNAJC12 promotes lung cancer growth by regulating the activation of β-catenin
    Article Snippet: .. Short hairpin RNA (shRNA/sh) targeting DNAJC12 (shDNAJC12; 5′-GGATGTGATGAACTATCTT-3′) and control shRNA (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were cloned into GV115 plasmids (Shanghai GeneChem Co., Ltd.). .. For overexpression, the coding sequences of CTNNB1 (NM_001904.4), p65 (NM_021975.4), VIM (NM_003380.5) were cloned into GV610 vectors (Shanghai GeneChem Co., Ltd.).

    Control:

    Article Title: DNAJC12 promotes lung cancer growth by regulating the activation of β-catenin
    Article Snippet: .. Short hairpin RNA (shRNA/sh) targeting DNAJC12 (shDNAJC12; 5′-GGATGTGATGAACTATCTT-3′) and control shRNA (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′) were cloned into GV115 plasmids (Shanghai GeneChem Co., Ltd.). .. For overexpression, the coding sequences of CTNNB1 (NM_001904.4), p65 (NM_021975.4), VIM (NM_003380.5) were cloned into GV610 vectors (Shanghai GeneChem Co., Ltd.).



    Similar Products

    shctrl f 5  (Addgene inc)
    93
    Addgene inc shctrl f 5
    Shctrl F 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/pLKO%2E1+shControl+(Plasmid+%2374972)/pm39657676-812-9-57
    Average 93 stars, based on 1 article reviews
    shctrl f 5 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    shctrl 3/4  (GemPharmatech Co Ltd)
    90
    GemPharmatech Co Ltd shctrl 3/4
    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
    Shctrl 3/4, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/shctrl+3+4/pmc11321678-388-8-28
    Average 90 stars, based on 1 article reviews
    shctrl 3/4 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    shhtr2c, shgabrg2, and shctrl 3/4 cells  (GemPharmatech Co Ltd)
    90
    GemPharmatech Co Ltd shhtr2c, shgabrg2, and shctrl 3/4 cells
    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
    Shhtr2c, Shgabrg2, And Shctrl 3/4 Cells, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/shhtr2c++shgabrg2++and+shctrl+3+4+cells/pm38884167-504-3-27
    Average 90 stars, based on 1 article reviews
    shhtr2c, shgabrg2, and shctrl 3/4 cells - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l  (VectorBuilder GmbH)
    90
    VectorBuilder GmbH shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l
    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
    Shrnas Targeting Rosa26 (Shctrl) And The 3' Untranslated Region (3' Utr) Of Thoc1, Stau1, Serbp1, And Skiv2l, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/shrnas+targeting+rosa26++shctrl/10__1172_slash_jci163325-320-17-26
    Average 90 stars, based on 1 article reviews
    shrnas targeting rosa26 (shctrl) and the 3'-untranslated region (3'-utr) of thoc1, stau1, serbp1, and skiv2l - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3  (Addgene inc)
    95
    Addgene inc plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3
    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
    Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pmc10140597-109-0-5
    Average 95 stars, based on 1 article reviews
    plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    shctrl 5’-cctaaggttaagtcgccctcgctc-3  (Addgene inc)
    90
    Addgene inc shctrl 5’-cctaaggttaagtcgccctcgctc-3
    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
    Shctrl 5’ Cctaaggttaagtcgccctcgctc 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/shctrl+5%E2%80%99+cctaaggttaagtcgccctcgctc+3/pmc09883185-82-0-3
    Average 90 stars, based on 1 article reviews
    shctrl 5’-cctaaggttaagtcgccctcgctc-3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3  (Genechem)
    90
    Genechem egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3
    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA <t>(shCtrl),</t> shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).
    Egfr Knockdown Lentiviral Vectors Shctrl, Shegfr 1, Shegfr 2, Shegfr 3, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/egfr+knockdown+lentiviral+vectors+shctrl++shegfr+1++shegfr+2++shegfr+3/pmc09132982-279-8-26
    Average 90 stars, based on 1 article reviews
    egfr knockdown lentiviral vectors shctrl, shegfr-1, shegfr-2, shegfr-3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′)  (Shanghai GenePharma)
    90
    Shanghai GenePharma shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′)
    Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control <t>shRNA</t> and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short <t>hairpin</t> <t>RNA;</t> CTRL, control; PARP, poly(ADP-ribose) polymerase.
    Shrna Negative Control (Shctrl; Cat. No. 131127cz; 5′ Ttctccgaacgtgtcacgtttc 3′), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/shrna+negative+control++shctrl++cat++no++131127cz++5++ttctccgaacgtgtcacgtttc+3++/pmc07751351-45-13-26
    Average 90 stars, based on 1 article reviews
    shrna negative control (shctrl; cat. no. 131127cz; 5′-ttctccgaacgtgtcacgtttc-3′) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3)  (Genechem)
    90
    Genechem non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3)
    Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control <t>shRNA</t> and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short <t>hairpin</t> <t>RNA;</t> CTRL, control; PARP, poly(ADP-ribose) polymerase.
    Non Silencing Control (Shctrl, Target Sequence 5’–Ttctccgaacgtgtcacgt–3), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+3/non+silencing+control/pmc06991670-63-13-22
    Average 90 stars, based on 1 article reviews
    non-silencing control (shctrl, target sequence 5’–ttctccgaacgtgtcacgt–3) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA (shCtrl), shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).

    Journal: Advanced Science

    Article Title: Single‐Cell Chromatin Accessibility Analysis Reveals Subgroup‐Specific TF‐NTR Regulatory Circuits in Medulloblastoma

    doi: 10.1002/advs.202309554

    Figure Lengend Snippet: Inhibiting NTRs in MB cells affects the in vitro sphere‐forming ability and in vivo tumorigenic capacity. A,B) Extreme limiting dilution assays (ELDAs) were conducted to assess the ability of cells to form colonies, demonstrating a decrease in neurosphere frequency upon NTR inhibition in Group 3 (HTB‐187) or Group 3/4 (HTB‐185) cells. HTB‐185 and HTB‐187 cells were seeded in 24‐well ultra‐low attachment plates at various concentrations, including 100, 50, 25, 10, and 5 cells per well. Each sphere‐forming well was counted and the dilution ratio was plotted based on the number of diluted cells and the number of sphere‐forming wells. **** P < 0.0001. C) Display of representative spheres derived from Group 3 or Group 3/4 cells expressing either control shRNA (shCtrl), shHTR2C, or shGABRG2. Images of colonies were captured after 1 week of incubation. D,E) Relative HTR2C or GABRG2 expression was measured by qRT‐PCR in shCtrl, shHTR2C, and shGABRG2 Group3/4 cells. Data are shown as the mean ± SEM. ** P < 0.01. F) left, HE staining of the maximum cross‐sectional area of G3/4 intracranial orthotopic xenograft model among each group. G) Statistical results of the percentage of medulloblastoma tumor size divide the whole section. Data are expressed as dots. ** P < 0.01. H) Immunofluorescence staining of GFAP, IBA1, NeuN revealed less GFAP and increased IBA1 signal in shHTR2C and shGABRG2 groups. Shown are representative images from at least three mice with similar results. I,J) Quantification of GFAP and IBA1 of each group described in H. * P < 0.05, ** P < 0.01, **** P < 0.0001. (Scale bars: 50 µm in C, 2 mm in F, 100 µm in H).

    Article Snippet: Subsequently, 1 × 10 6 shHTR2C, shGABRG2, and shCtrl Group 3/4 cells in 2 μl PBS were carefully injected into the cerebellum of 6–8week‐old female nude mice (BABL/c, Gempharmatech Co., Ltd, China) at the coordinates 2 mm lateral to midline and 1 mm posterior to lambda.

    Techniques: In Vitro, In Vivo, Inhibition, Derivative Assay, Expressing, Control, shRNA, Incubation, Quantitative RT-PCR, Staining, Immunofluorescence

    Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control shRNA and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short hairpin RNA; CTRL, control; PARP, poly(ADP-ribose) polymerase.

    Journal: Oncology Letters

    Article Title: Inhibition of autophagy enhances apoptosis induced by bortezomib in AML cells

    doi: 10.3892/ol.2020.12370

    Figure Lengend Snippet: Downregulation of Beclin-1 enhances apoptosis and reduces cell viability induced by bortezomib in NB4 cells. Cells were infected with lentiviruses expressing shRNAs (non-targeting control or Beclin-1). Puromycin-resistant cells were pooled after each infection. (A) Cells transfected with the control shRNA and shBeclin-1 were treated with or without bortezomib (20 nM) for 24 h, and the expression levels of cleaved caspase-3, cleaved PARP, Bcl-2, p62 and Beclin-1, and LC3-I to LC3-II conversion were determined by western blotting. (B) Ratio of Bcl-2 and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. *P<0.05 and **P<0.01. (C) Ratio of LC3-II and β-actin expression levels. Data are presented as the mean ± standard deviation of three independent repeats. **P<0.01. (D) Cells transfected with the control shRNA and shBeclin-1 were treated with bortezomib (20 nM) for 0 and 24 h, and cell viability was assessed using a water-soluble tetrazolium salts-8 assay. Data are presented as the mean ± standard deviation of three independent repeats. ***P<0.001. shRNA/sh, short hairpin RNA; CTRL, control; PARP, poly(ADP-ribose) polymerase.

    Article Snippet: Lentiviral particles containing short hairpin RNA (shRNA/sh) Beclin-1 (cat. no. 131209BZ; 5′-CCGACTTGTTCCTTACGGAAA-3′) and shRNA negative control (shCTRL; cat. no. 131127CZ; 5′-TTCTCCGAACGTGTCACGTTTC-3′) expression vectors were obtained from Shanghai GenePharma Co., Ltd., and were then cloned into pGLV3/H1/GFP-Puro vector (Shanghai GenePharma Co., Ltd.).

    Techniques: Infection, Expressing, Transfection, shRNA, Western Blot, Standard Deviation